Suoritettu

Visual Basic Entry Level

Need two (2) entry/beginner level Visual Basic programs to be completed by next week September 23, 2004. These programs have to be done in the simplest form possible. Compensation is negotiable. Thank you in advance.

**_Program #1.

_**

Search the DNA strand nucleotide sequence given below for the occurrence of a shorter sequence TATAAA. Search the sequence and its complement in both directions. Indicate graphically where on the original strand the shorter sequence is found.

ATCCATTACAGGTCACTTTATAAACACCCCCATTAGT

ACTATAAATCGACAAATATCCAGTACTCAGGACGCA

TTCATTATAAAGCATCGATCCAAACTAAGCGAGTACG

CACGATCAGCATTCGATCAGTCAGATGTATCCATTAGAGG

_**Program #2.

**_

Animate a simple drawing of a water molecule (a color-filled circle representing the oxygen atom, two smaller color-filled circles connected by lines between the circles' centers, representing the covalent bonds). Make the molecule move from the lower left quadrant to the upper right quadrant of the screen, with the molecule rotating slowly and smoothly as it moves across the screen.

## Deliverables

1) Complete and fully-functional working program(s) in executable form as well as complete source code of all work done.

2) Deliverables must be in ready-to-run condition, as follows (depending on the nature of the deliverables):

a) For web sites or other server-side deliverables intended to only ever exist in one place in the Buyer's environment--Deliverables must be installed by the Seller in ready-to-run condition in the Buyer's environment.

b) For all others including desktop software or software the buyer intends to distribute: A software installation package that will install the software in ready-to-run condition on the platform(s) specified in this bid request.

3) All deliverables will be considered "work made for hire" under U.S. Copyright law. Buyer will receive exclusive and complete copyrights to all work purchased. (No GPL, GNU, 3rd party components, etc. unless all copyright ramifications are explained AND AGREED TO by the buyer on the site per the coder's Seller Legal Agreement).

## Platform

Visual Basic

Taidot: .NET, tekniikka, MySQL, PHP, tietojärjestelmäarkkitehtuuri, Ohjelmistojen testaus, Visual Basic

Näytä lisää: visual basic coder for hire, one source water, lines of a circle, level two, level s, level one, hire visual basic coder, hire visual basic, entry level it, dna coder, code source visual basic, visual basic web, animate web, visual search, visual b, molecule, hire visual basic code, entry level, entry level php , dna

Tietoa työnantajasta:
( 0 arvostelua ) United States

Projektin tunnus: #3352851

Myönnetty käyttäjälle:

eroberts

See private message.

$68 USD 7 päivässä
(0 Arvostelua)
1.7

25 freelanceria on tarjonnut keskimäärin %project_bid_stats_avg_sub_26% %project_currencyDetails_sign_sub_27% tähän työhön

thetoxic

See private message.

$25.5 USD 7 päivässä
(40 arvostelua)
6.0
ivandunaev

See private message.

$25.5 USD 7 päivässä
(56 arvostelua)
5.7
DrumLin

See private message.

$68 USD 7 päivässä
(34 arvostelua)
5.4
ebshightechvw

See private message.

$42.5 USD 7 päivässä
(81 arvostelua)
5.4
peterjl

See private message.

$68 USD 7 päivässä
(75 arvostelua)
5.3
lovleetvw

See private message.

$68 USD 7 päivässä
(27 arvostelua)
4.7
diacope

See private message.

$38.25 USD 7 päivässä
(27 arvostelua)
4.7
simonnattress

See private message.

$34 USD 7 päivässä
(21 arvostelua)
4.4
onesource

See private message.

$59.5 USD 7 päivässä
(23 arvostelua)
3.9
crimsonk

See private message.

$51 USD 7 päivässä
(6 arvostelua)
3.7
milanvrekich

See private message.

$17 USD 7 päivässä
(24 arvostelua)
3.8
ambaalaji

See private message.

$17 USD 7 päivässä
(4 arvostelua)
3.2
lemurvw

See private message.

$34 USD 7 päivässä
(2 arvostelua)
2.2
vroscioli

See private message.

$25.5 USD 7 päivässä
(13 arvostelua)
2.2
khurrambinumer

See private message.

$25.5 USD 7 päivässä
(13 arvostelua)
1.9
jay797

See private message.

$34 USD 7 päivässä
(4 arvostelua)
1.1
danielgrout

See private message.

$34 USD 7 päivässä
(6 arvostelua)
1.1
roshobaba

See private message.

$21.25 USD 7 päivässä
(0 arvostelua)
0.0
engammarvw

See private message.

$12.75 USD 7 päivässä
(0 arvostelua)
0.0
prekageo

See private message.

$17 USD 7 päivässä
(0 arvostelua)
0.0