Dennis a 2012 systems analysis and design john wiley sons inc työt

Suodata

Viimeisimmät hakuni
Suodatusperuste:
Budjetti
asti
asti
asti
Tyyppi
Taidot
Kielet
    Työn tila
    319,598 dennis a 2012 systems analysis and design john wiley sons inc työtä löytyi, hinnoittelu EUR

    engneering

    €81 (Avg Bid)
    €81 Keskimäär. tarjous
    10 tarjoukset

    in attached ....................................................

    €382 (Avg Bid)
    €382 Keskimäär. tarjous
    2 tarjoukset

    Moro, Mulla olisi sulle työtarjous! Jos voisit tehdä mulle simppelin tietokannan ~5 taululla, ja kerrot vähän perusjuttuja sql serverin toiminnoista jne, niin ota yhteyttä ja jutellaan tarkemmin. Arvioisin, että tässä ei montaa tuntia menisi. Riippuen toki kuinka hyvin nuo sql perusjutut osaat ;)

    SQL
    €155 (Avg Bid)
    €155 Keskimäär. tarjous
    3 tarjoukset

    Moi! Osaatko kuinka hyvin sql:n perusasiat? Onnistuuko asentaa tietokannan hallintajärjestelmä, luoda ja hallinnoida tietokantoja sekä käyttäjätilejä ŠŠ ,seurata ja optimoida tietokannan toimintaa. Jos perusasiat hoidossa niin ota yhteyttä :)

    SQL
    €126 (Avg Bid)
    €126 Keskimäär. tarjous
    1 tarjoukset

    Moro, Mulla olisi sulle työtarjous! Jos voisit tehdä mulle simppelin tietokannan ~5 taululla, ja kerrot vähän perusjuttuja sql serverin toiminnoista jne, niin ota yhteyttä ja jutellaan tarkemmin. Arvioisin, että tässä ei montaa tuntia menisi. Riippuen toki kuinka hyvin nuo sql perusjutut osaat ;)

    SQL
    €126 - €126
    €126 - €126
    0 tarjoukset
    Mobile App Android and iOS UX/UI designer 6 päivää left
    VARMENNETTU

    We are looking for an experienced UI/IX designer to create the user experience for a mobile phone app that will be primarily used on Android and iOS phone systems. You will need to interact and work with a team in a collaboration effort to bring your creative to the project. You will also need to work continuously to complete the project. You will be interfacing with a team in the PST time zone...

    €18 / hr (Avg Bid)
    €18 / hr Keskimäär. tarjous
    7 tarjoukset

    Development and maintenance of web systems in PHP, mysql, JQuery, Angular and react. System is an ERP with several customer registration modules, agenda, lawsuits, financial, projects, etc. API integrations RESTFULL, json, soap, webservice. Advanced experience required in php, crud, pdo.

    €28 / hr (Avg Bid)
    €28 / hr Keskimäär. tarjous
    8 tarjoukset
    Descriptive analysis 6 päivää left

    Descriptive analysis to predict stock price using Python

    €24 (Avg Bid)
    €24 Keskimäär. tarjous
    8 tarjoukset

    UPDATE: please DON’T APPLY if your English is IS NOT PERFECT or if you don’t care to read the project description. I can tell by the way your proposal is worded if you can/cannot do this job, so you just wasting your bids. And I'm not a "sir"... Thanks and have a nice day! :) Hi there! I'm looking for a virtual assistant to help me with emailing potential client...

    €13 / hr (Avg Bid)
    €13 / hr Keskimäär. tarjous
    18 tarjoukset

    I am looking for business proposal draft for my business pitch. The content needed are marketing validation, financial projection, competitor analysis. Would like to seek for your advice

    €2160 (Avg Bid)
    €2160 Keskimäär. tarjous
    1 tarjoukset

    I want an expert in power system analysis to help me with my project. and he must know the power world program so well

    €134 (Avg Bid)
    €134 Keskimäär. tarjous
    5 tarjoukset

    I need someone who can pull data (need to write a code in python to pull the data from the website and automate it). once you have the data then you need to analyze it, I will discuss those points in PM and finally prepare the presentation and provide recommendations. Thanks

    €80 (Avg Bid)
    €80 Keskimäär. tarjous
    11 tarjoukset
    Data analysis project 6 päivää left

    I am badly in need of someone who can convert written images to PDF documents I will pay such person very well

    €290 (Avg Bid)
    €290 Keskimäär. tarjous
    19 tarjoukset

    I need a professional who can handle microsoft word packages and power point presentation including excel packages, to handle office files

    €316 (Avg Bid)
    €316 Keskimäär. tarjous
    15 tarjoukset

    You need to be familiar with sorting algorithms, their time complexity, analysis etc. 1. Algorithms (definition, analysis, complexity etc.). 2. Sorting including mergesort, quicksort, heapsort and related questions like heapification etc. 3. Dynamic programming algorithms including knapsack, matrix chain, longest common subsequence, transitive closure, recurrences.

    €56 (Avg Bid)
    €56 Keskimäär. tarjous
    11 tarjoukset

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €422 - €843
    €422 - €843
    0 tarjoukset

    Milestone1: Upto 2-3 Pages It should contain the following. 1. Project charter 2. Problem statement – Existing problem or Goal statement – New / Idea 3. Business case Why is this project worth doing now? What are the consequences of not doing this project? Declare processes on the basis of priority (high , medium & low). It shoul...

    €60 (Avg Bid)
    €60 Keskimäär. tarjous
    5 tarjoukset

    Hi, I’m looking for an expert in statistics and especially operations research, he or she need to be available immediately to help solve problems in operations research related to the following topics and concepts: - Linear programming - Sensitivity analysis - Graphical method - Simplex method - Shadow price - Dual problems - Binding & non-binding constraints Must be expert in the menti...

    €40 (Avg Bid)
    €40 Keskimäär. tarjous
    8 tarjoukset

    Hi usman1493, I noticed your profile and would like to offer you my project. We can discuss any details over chat.

    €84 (Avg Bid)
    €84 Keskimäär. tarjous
    1 tarjoukset

    We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...

    €253 (Avg Bid)
    €253 Keskimäär. tarjous
    7 tarjoukset

    In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...

    €30 (Avg Bid)
    €30 Keskimäär. tarjous
    1 tarjoukset

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    €93 (Avg Bid)
    €93 Keskimäär. tarjous
    23 tarjoukset

    Informational article: [kirjaudu nähdäksesi URL:n] [kirjaudu nähdäksesi URL:n] REQUIRES: experience with : mysql, built tools maven, docker, familiarity with Radiology Information systems, PACS integration HL7

    €525 (Avg Bid)
    €525 Keskimäär. tarjous
    2 tarjoukset
    Finance project 6 päivää left
    VARMENNETTU

    I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10

    €14 (Avg Bid)
    €14 Keskimäär. tarjous
    13 tarjoukset
    Article analysis 6 päivää left
    VARMENNETTU

    Article analysis following certain criteria.

    €18 (Avg Bid)
    €18 Keskimäär. tarjous
    29 tarjoukset
    Brand Promotion Video 6 päivää left

    I require a brand promotion video for my brand "AlphaDrip". We are manufacturers of Drip Irrigation Systems and our target audience is Rural Audience

    €10 (Avg Bid)
    €10 Keskimäär. tarjous
    5 tarjoukset

    What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...

    €85 (Avg Bid)
    €85 Keskimäär. tarjous
    20 tarjoukset

    The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...

    €178 (Avg Bid)
    €178 Keskimäär. tarjous
    13 tarjoukset
    BR Security systems 6 päivää left

    Required SEO for my Website [kirjaudu nähdäksesi URL:n]

    €60 (Avg Bid)
    €60 Keskimäär. tarjous
    14 tarjoukset
    Database Management Systems project -- 3 6 päivää left
    VARMENNETTU

    I need help in Database Management Systems project Deadline is April 15 topics included for the project - Entity Relationship Model - Relational Data Model - Relational Algebra - Relational Calculus

    €65 (Avg Bid)
    €65 Keskimäär. tarjous
    6 tarjoukset
    sistema ERP 6 päivää left

    Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...

    €3865 (Avg Bid)
    €3865 Keskimäär. tarjous
    5 tarjoukset

    I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.

    €83 (Avg Bid)
    €83 Keskimäär. tarjous
    20 tarjoukset

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    €113 (Avg Bid)
    €113 Keskimäär. tarjous
    15 tarjoukset

    I would like to build a deep learning model using NLP that is able to recognize hidden costs in a 10-K or 10-Q financial statement, and extract the monetary value. There are about 7 different expense categories, each category has different keywords. Here are some examples: --- "Exploratory dry-hole costs were $12.7 million, $1.3 million, and $1.0 million for the years ended December 31, 2...

    €629 (Avg Bid)
    €629 Keskimäär. tarjous
    9 tarjoukset

    Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.

    €23 (Avg Bid)
    €23 Keskimäär. tarjous
    5 tarjoukset
    Pharma delivery marketplace 6 päivää left
    VARMENNETTU

    Hello everyone. we are looking for a company or freelancer that has already developed a drug delivery marketplace. essential features: - exhaustive documentation - developed with an MVC php framework with API - multi language - performance and scalability - code security (OWASP) - user permissions - sms, email marketing etc. - Integration with payment systems - iOS and Android app - App for track...

    €6691 (Avg Bid)
    €6691 Keskimäär. tarjous
    45 tarjoukset
    I need an R programmer 6 päivää left

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    €158 (Avg Bid)
    €158 Keskimäär. tarjous
    27 tarjoukset

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €17 - €141
    €17 - €141
    0 tarjoukset

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €17 - €141
    €17 - €141
    0 tarjoukset
    data entry operator 6 päivää left

    I have a data analysis task.i am very honest

    €3 / hr (Avg Bid)
    €3 / hr Keskimäär. tarjous
    7 tarjoukset

    Need to get designed Battery Management Systems (BMS) for Lithium batteries used in solar lights and solar plants for various Voltage and current ratings. Looking for experienced person in this field.

    €142 (Avg Bid)
    €142 Keskimäär. tarjous
    9 tarjoukset
    Genomics Variants Exploration -- 2 6 päivää left
    VARMENNETTU

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    €5 / hr (Avg Bid)
    €5 / hr Keskimäär. tarjous
    3 tarjoukset
    Laptop repairs and services -- 3 6 päivää left
    VARMENNETTU

    Hi, Are you great at repairing printers and Laptops/Computers? Want to work for one of the world's biggest technology companies? Are you located near (0-80km): 22 Salmon Street, Port Melbourne, VIC -3207. If you thrive on taking a customer centric based approach and have break/fix/repair skills for notebooks/laptops and printers, then we want to hear from you We are looking for Hardwa...

    €37 / hr (Avg Bid)
    Paikallinen
    €37 / hr Keskimäär. tarjous
    1 tarjoukset
    data processing 6 päivää left

    I have a data analysis task. I needed someone who can help me with this

    €1966 (Avg Bid)
    €1966 Keskimäär. tarjous
    13 tarjoukset

    The design of street lights using solar energy.

    €143 (Avg Bid)
    €143 Keskimäär. tarjous
    11 tarjoukset

    This position is responsible for coding, configuration, testing, system performance optimization, and interoperability issues. The Software Developer will work with business product owners, developers, and quality analysts to drive value delivery and will participate in all phases of Agile software development. As a Senior .NET Development Consultant, you will work closely with our clients and tec...

    €13 / hr (Avg Bid)
    €13 / hr Keskimäär. tarjous
    10 tarjoukset

    Hi ROSE&JOHN([kirjaudu nähdäksesi URL:n]), I noticed your profile and would like to offer you my project. We can discuss any details over chat.

    €213 (Avg Bid)
    €213 Keskimäär. tarjous
    1 tarjoukset
    Appointment Booking Tech Solution + ERP 6 päivää left
    VARMENNETTU

    Looking to develop an appointment booking tech solution for a start up company. Project -Website solution that is operating on 4 different modules/systems in one, generating subdomains based on client needs. -An iOS/Android app that's an adaptation of the website so clients can manage their businesses through the app -An iOS/Andoid aggregator app/marketplace -An ERP for the management of the...

    €13037 (Avg Bid)
    €13037 Keskimäär. tarjous
    16 tarjoukset
    Data entry 6 päivää left

    You have to add questions and categories to a quiz portal. You have to google and copy paste 1000 questions in each of the categories. I will give you total 50 categories. So in total you have to add 50,000 questions. Time: 1 day Link to add the questions and categories: [kirjaudu nähdäksesi URL:n] 1. Elon Musk 2. SpaceX 3. Tesla 4. Apple Inc 5. Steve Jobs 6. Microsoft Inc 7. Bill Gat...

    €21 (Avg Bid)
    €21 Keskimäär. tarjous
    25 tarjoukset